The top 5 compounds from libraries HF9PlatesPlates5_9.sdf and cb_306_3d.sdf.
An inhibition assay was done on the surrogate target YopH. The results of the assay were varied, and there was no real pattern. The failure to show any patterns is most likely due to errors setting up the assay. Several of the samples were actually prepared incorrectly, so they had to be remade. It's possible that the discrepancy in incubation time at room temperature between the samples that were made correctly and the samples that had to be remade is responsible for some of the variation. Additionally, the samples were all put in the water bath before any of the substrate was added, so that may have influenced the results as well.
An enzyme assay was done on FabG. The blue line measured absorbance at 340nm (NADPH) and the red 260nm (NADP+). The decrease in
the blue line shows that the protein has some sort of activity going on. More runs will be necessary to check for consistency of the protein, and also to see how change in substrate affects the progression of the reaction.
Week 11 & 12 4-Nov - 17-Nov
Library Screening:
Screening against two libraries has been started, HF9PlatesPlates5_9.sdf and HF9_180_Plates_lum3D_catnum.sdf.
For HF9Plates..., all 400 compounds were run at an autoscale of 2 on one blade. For the HF9_180... library, compounds were divided up amoung 6 blades, with 2400 compounds per blade, for a total of 14400 compounds. The autoscale was set to 0.1 for this library so that it would run faster.
Future errors to avoid: make sure the file path is correct, don't accidentally change the conf file for a run.
The gold.conf file for HF9PlatesPlates5_9.sdf.
The gold.conf file for HF9_180_Plates_lum3D_catnum.sdf
Images of Control Docking Results: Results from control docking were quite different from what I expected. Some of the negative controls performed better than the positive controls, and the scores of the positive controls were relatively low, given that they had good IC50 values based off previous studies.
Something that should be noted is that the second substrate, NADPH, was not present in the control docking procedure. Some of the positive and negative controls appear to clash with the NADPH site, so it may be wise to rerun the entire control procedure with NADPH in the site (after docking the NADPH) to ensure that these compounds are binding in the correct sites. Even though previous papers have noted that NADPH is not completely necessary in the inhibition of FabG in Plasmodium Falciparum, it would be better to double check.
The listing of the pymol images is in the same order of the compounds in the chart below. Physio-chemical properties displayed in the chart below were taken from Zinc and PubChem.
Week 9 & 10 21-Oct - 3-Nov
Good work! Continue with virtual screening of control ligands and protein expression. - Suman 11/5/13
The next step in virtual would be to start screening against my control ligands after consulting with a mentor/Dr.B.
For wet lab, protein expression sometime this week.
Jason do you have any data for weeks 7 & 8? Please upload what data you do have. Thank you. -Max 10/21/13 Week 5 & 6 23-Sep - 6-Oct Jason nice job on adding your data but try to include captions and an analyses for the data. Thank you. -Max 10/07/2013
The resulting plasmids were sent off to DNA sequencing to determine whether or not the proper sequence was accepted by the plasmid
Clone 1
Clone 2
Clone 3
Week 3 & 4 9-Sep - 22-Sep
Jason - resutls of your cloning? Also do you have some virtual work yet? - Dr. B 100113 2013.09.18 Cohesive End Generation -nothing to show yet-
2013.09.13 Vector Digest (pNIC-Bsa4)
Two samples were made, one containing three tubes of digested pNIC, and one with five tubes of digested pNIC. The results of the sample containing three volumes of digested pNIC is on the left, and the results of the one with five volumes is on the right. For cloning, the one on the right will be used first.
-Bands on the gels to make sure they were the right lengths (5.3kB and 1.9kB)
2013.09.10 PCR Squared
Another PCR squared after the previous one had poor yields. This time, 400uL of PCR product was used compared to 200uL time, and the extracted DNA was collected into only one column in 40uL of elution buffer.
Each lane in the pictures below contained 50uL PCR product with 16.667uL of dye. The leftmost lanes on the two gels is the 1kB ladder, which helps make sure that the correct gene sequence was amplified (903bp long).
Gel Extraction
This extraction was much more successful than the previous attempt. This product will be viable for cloning.
2013.09.08 Gel Extraction
The first gel extraction resulted in a poor final concentration, mainly due to a low amount of PCR squared and the use of two final columns instead of one.
-Column 1
-Column 2
Week 1, 2:26.08.2013 - 06.09.2013
Jason - good. Don't put link to WORD docs here. I just want embedded images. Thanks. Dr. B 090913 03.09.2013
PCR pGBR22 (06.18.2013)
Lane 1: 100 bp DNA ladder
Lane 2: Sample A [1:1000 template dilution, 1uL]
Lane 3: Sample B [1:1000 template dilution, 10uL]
Lane 4: Sample C [1:100 template dilution, 10uL]
Lane 5: Sample D [control]
PCR pmCherry (06.18.2013)
Lane 1: 100 bp ladder
Lane 2: VDSR1/2, 1:1000 dilution
Lane 2: VDSR1/2, 1:100 dilution
Lane 2: VDSR1/2, 1:10 dilution
Lane 2: VDSR1/2, no DNA
Lane 6: 100 bp ladder
Lane 7: M13 Forward/Reverse, 1:1000 dilution
Lane 8: M13 Forward/Reverse, 1:100 dilution
Lane 9: M13 Forward/Reverse, 1:10 dilution
Lane 10: M13 Forward/Reverse, no DNA
pGBR22 Sequence Verification
Week 2:
pGBR22 Colonies:
pGBR22 Nanodrop Spectrophotometer Results:
Trial 1:
Trial 2:
The average concentration of the sample was 45.25 ng/uL.
PCR pGBR22 (06.14.2013)
Lane 1-5: Vicki's
Lane 6: 1 kb DNA ladder
Lane 7: Sample A [1:1000 template dilution, 1uL]
Lane 8: Sample B [1:1000 template dilution, 10uL]
Lane 9: Sample C [1:100 template dilution, 10uL]
Lane 10: Sample D [control]
Week 1
pGFP Nanodrop Spectrophotometer Results:
Run 1:
Run 2:
The results from the two trials provided similar data for the purity of the sample in comparison to protein (260/280) and in comparison with to other contaminants (260/230). The average purity in relation to protein was 1.855, and the average purity in relation to other contaminants was 2.315.
Although purity measures were similar, there was a rather large difference between the two measures of concentration, about a 330 ng/uL discrepancy. This could possibly indicate that the plasmid concentration was not consistent throughout the sample.
Lane 1: 1 kb DNA ladder
Lane 2: Sample A [1:1000 template dilution, 1uL]
Lane 3: Sample B [1:1000 template dilution, 10uL]
Lane 4: Sample C [1:100 template dilution, 10uL]
Lane 5: Sample D [control]
Jason - good job. Segment your stuff by Week 1, Week 2, etc.. put weeks in reverse chronological order. -- Dr. B
FALL 2013
Week 13, 14. 15 18-Nov - 8-Dec
The top 5 compounds from libraries HF9PlatesPlates5_9.sdf and cb_306_3d.sdf.An inhibition assay was done on the surrogate target YopH. The results of the assay were varied, and there was no real pattern. The failure to show any patterns is most likely due to errors setting up the assay. Several of the samples were actually prepared incorrectly, so they had to be remade. It's possible that the discrepancy in incubation time at room temperature between the samples that were made correctly and the samples that had to be remade is responsible for some of the variation. Additionally, the samples were all put in the water bath before any of the substrate was added, so that may have influenced the results as well.
An enzyme assay was done on FabG. The blue line measured absorbance at 340nm (NADPH) and the red 260nm (NADP+). The decrease in
the blue line shows that the protein has some sort of activity going on. More runs will be necessary to check for consistency of the protein, and also to see how change in substrate affects the progression of the reaction.
Week 11 & 12 4-Nov - 17-Nov
Library Screening:
Screening against two libraries has been started, HF9PlatesPlates5_9.sdf and HF9_180_Plates_lum3D_catnum.sdf.
For HF9Plates..., all 400 compounds were run at an autoscale of 2 on one blade. For the HF9_180... library, compounds were divided up amoung 6 blades, with 2400 compounds per blade, for a total of 14400 compounds. The autoscale was set to 0.1 for this library so that it would run faster.
Future errors to avoid: make sure the file path is correct, don't accidentally change the conf file for a run.
The gold.conf file for HF9PlatesPlates5_9.sdf.
The gold.conf file for HF9_180_Plates_lum3D_catnum.sdf
Images of Control Docking Results:
Results from control docking were quite different from what I expected. Some of the negative controls performed better than the positive controls, and the scores of the positive controls were relatively low, given that they had good IC50 values based off previous studies.
Something that should be noted is that the second substrate, NADPH, was not present in the control docking procedure. Some of the positive and negative controls appear to clash with the NADPH site, so it may be wise to rerun the entire control procedure with NADPH in the site (after docking the NADPH) to ensure that these compounds are binding in the correct sites. Even though previous papers have noted that NADPH is not completely necessary in the inhibition of FabG in Plasmodium Falciparum, it would be better to double check.
The listing of the pymol images is in the same order of the compounds in the chart below. Physio-chemical properties displayed in the chart below were taken from Zinc and PubChem.
Week 9 & 10 21-Oct - 3-Nov
Good work! Continue with virtual screening of control ligands and protein expression. - Suman 11/5/13
The next step in virtual would be to start screening against my control ligands after consulting with a mentor/Dr.B.
For wet lab, protein expression sometime this week.
Jason do you have any data for weeks 7 & 8? Please upload what data you do have. Thank you. -Max 10/21/13
Week 5 & 6 23-Sep - 6-Oct
Jason nice job on adding your data but try to include captions and an analyses for the data. Thank you. -Max 10/07/2013
2013.10.03
DNA sequencing of miniprep product
Clone 1 (primer: pLIC-forward)
Range 1: 103 to 137
Alignment statistics for match #1||~ Score
Query 1 ATGTCTGTACTCCACCGCTTTTACCTCTTTTTCCT 35 ||||||||||||||||||||||||||||||||||| Sbjct 103 ATGTCTGTACTCCACCGCTTTTACCTCTTTTTCCT 137Clone 2 (primer: pLIC-forward)
Range 1: 100 to 134
Alignment statistics for match #1||~ Score
Query 1 ATGTCTGTACTCCACCGCTTTTACCTCTTTTTCCT 35 ||||||||||||||||||||||||||||||||||| Sbjct 100 ATGTCTGTACTCCACCGCTTTTACCTCTTTTTCCT 134Clone 3 (primer: pLIC-forward)
Range 1: 100 to 134
Alignment statistics for match #1||~ Score
Query 1 ATGTCTGTACTCCACCGCTTTTACCTCTTTTTCCT 35 ||||||||||||||||||||||||||||||||||| Sbjct 100 ATGTCTGTACTCCACCGCTTTTACCTCTTTTTCCT 134Will have to retry cloning.
2013.10.02
Miniprep
The resulting plasmids were sent off to DNA sequencing to determine whether or not the proper sequence was accepted by the plasmid
Clone 1
Clone 2
Clone 3
Week 3 & 4 9-Sep - 22-Sep
Jason - resutls of your cloning? Also do you have some virtual work yet? - Dr. B 100113
2013.09.18
Cohesive End Generation
-nothing to show yet-
2013.09.13
Vector Digest (pNIC-Bsa4)
Two samples were made, one containing three tubes of digested pNIC, and one with five tubes of digested pNIC. The results of the sample containing three volumes of digested pNIC is on the left, and the results of the one with five volumes is on the right. For cloning, the one on the right will be used first.
-Bands on the gels to make sure they were the right lengths (5.3kB and 1.9kB)
2013.09.10
PCR Squared
Another PCR squared after the previous one had poor yields. This time, 400uL of PCR product was used compared to 200uL time, and the extracted DNA was collected into only one column in 40uL of elution buffer.
Each lane in the pictures below contained 50uL PCR product with 16.667uL of dye. The leftmost lanes on the two gels is the 1kB ladder, which helps make sure that the correct gene sequence was amplified (903bp long).
Gel Extraction
This extraction was much more successful than the previous attempt. This product will be viable for cloning.
2013.09.08
Gel Extraction
The first gel extraction resulted in a poor final concentration, mainly due to a low amount of PCR squared and the use of two final columns instead of one.
-Column 1
-Column 2
Week 1, 2: 26.08.2013 - 06.09.2013
Jason - good. Don't put link to WORD docs here. I just want embedded images. Thanks. Dr. B 090913
03.09.2013
PymolRefresher
Secondary PCR:
05.09.2013
PCR Squared:
SUMMER 2013
Week 5:
Primers for HpPAP_FOR, HpPAP_REV (07.01.2013)
Forward: TACTTCCAATCCATGAAAAAAACCTTCCTGATCGCG
Reverse: TATCCACCTTTACTGTTAACGGGTCTTTGCAGAAGA
Week 4:
Analyzing a DNA sequence (pGBR22) -- work only:
Nanodrops of Purified Protein (FtHap)
Elution 1:
Elution 2:
Week 3:
PCR pGBR22 (06.18.2013)
Lane 1: 100 bp DNA ladder
Lane 2: Sample A [1:1000 template dilution, 1uL]
Lane 3: Sample B [1:1000 template dilution, 10uL]
Lane 4: Sample C [1:100 template dilution, 10uL]
Lane 5: Sample D [control]
PCR pmCherry (06.18.2013)
Lane 1: 100 bp ladder
Lane 2: VDSR1/2, 1:1000 dilution
Lane 2: VDSR1/2, 1:100 dilution
Lane 2: VDSR1/2, 1:10 dilution
Lane 2: VDSR1/2, no DNA
Lane 6: 100 bp ladder
Lane 7: M13 Forward/Reverse, 1:1000 dilution
Lane 8: M13 Forward/Reverse, 1:100 dilution
Lane 9: M13 Forward/Reverse, 1:10 dilution
Lane 10: M13 Forward/Reverse, no DNA
pGBR22 Sequence Verification
Week 2:
pGBR22 Colonies:
pGBR22 Nanodrop Spectrophotometer Results:
Trial 1:
Trial 2:
The average concentration of the sample was 45.25 ng/uL.pGBR22 DNA Sequencing Results:
PCR pGBR22 (06.14.2013)
Lane 1-5: Vicki's
Lane 6: 1 kb DNA ladder
Lane 7: Sample A [1:1000 template dilution, 1uL]
Lane 8: Sample B [1:1000 template dilution, 10uL]
Lane 9: Sample C [1:100 template dilution, 10uL]
Lane 10: Sample D [control]
Week 1
pGFP Nanodrop Spectrophotometer Results:
Run 1:
Run 2:
The results from the two trials provided similar data for the purity of the sample in comparison to protein (260/280) and in comparison with to other contaminants (260/230). The average purity in relation to protein was 1.855, and the average purity in relation to other contaminants was 2.315.Although purity measures were similar, there was a rather large difference between the two measures of concentration, about a 330 ng/uL discrepancy. This could possibly indicate that the plasmid concentration was not consistent throughout the sample.
pGFP DNA Sequencing Results:
PCR pGBR22 (06.07.2013)
Lane 1: 1 kb DNA ladder
Lane 2: Sample A [1:1000 template dilution, 1uL]
Lane 3: Sample B [1:1000 template dilution, 10uL]
Lane 4: Sample C [1:100 template dilution, 10uL]
Lane 5: Sample D [control]
Jason - good job. Segment your stuff by Week 1, Week 2, etc.. put weeks in reverse chronological order. -- Dr. B